nyest.hu
Kövessen, kérem!

Nem lát minket a Facebookon?

Kenyérpirítón szeretné?

Legutolsó hozzászólások
A nyelvész majd megmondja
A legnépszerűbb anyagok
Írjon! Nekünk!
nyest.hu
nyest.hu
 
Lefordították Shakespeare szonettjeit DNS-re

Shakespeare 154 szonettjét, egy Martin Luther King-beszédet és egy genetikai alapcikket is átkódoltak a DNS-re, hogy bebizonyítsák, milyen rengetegféle információt lehet tárolni ebben a formában – rendkívül gazdaságosan.

nyest.hu | 2013. január 26.
|  

A világ leghíresebb szerelmes versei, amelyek világszerte rengeteg olvasót nyűgöztek le szépségükkel, ugyanolyan módon is kódolhatók, ahogyan az egyes tulajdonságaink a genetikai állományunkban. Ez is bizonyítja, hogy a DNS-kód segítségével milyen elképesztő mennyiségű adat tárolható és archiválható akár tízezer évekre. A kódolást végző cambridge-i tudósok azonban nem álltak meg Shakespeare-nél: DNS-láncokkal kódolták Martin Luther King híres 1963-as beszédének („Van egy álmom...”) hangzó változatát, illetve Francis Crick és James Watson híres tanulmányát a DNS kettős hélixének szerkezetéről.

A DNS-sel való kódolás gazdaságosabb, mint gondolnánk. Shakespeare szonettjei DNS-ben kódolva 0,3 pikogrammot (10-12 grammot) nyomnak. Egy gramm DNS pedig több információt képes tárolni, mint egy millió darab CD. Így elég kézenfekvőnek tűnik az ötlet, hogy a digitálisan kódolt információkat megpróbálják a DNS-szekvencia kódjára átültetni.

Nick Goldman és Ewan Birney a Cambridge melleti European Bioinformatics Institute kutatói az ötletet először egy hamburgi kocsmában vetették fel.  Azon gondolkodtak éppen, hogy milyen alternatívák találhatók a növekvő információmennyiség tárolására a drága merevlemezek helyett. Azt tudták, hogy a DNS elképesztő hatékonyan és tömören képest az információtárolásra, és hogy a digitálisan (nullákkal és egyekkel) kódolt verbális, vizuális stb. információ átkódolható DNS-kóddal is.

A tudósok tehát egy olyan kódolási módszert fejlesztettek ki, amely a genetikai kód négy alapkövét a G-t (guanint), a C-t (citozint), az A-t (adenint) és a T-t (timint) használja az információk tárolására. A digitálisan fájlok nullákból és egyekből álló sorozatokként tárolják az információt. A cambridge-i kutatócsoport kódolója pedig minden 8 számjegyből álló sorozatot átkódol egy ötbetűs DNS-kóddá. Például a t betű 8 számjegy hosszúságú digitális kódjának a „TAGAT” DNS-szekvencia felel meg.

A DNS szerkezete
A DNS szerkezete
(Forrás: Wikimedia Commons / Zephyris / CC BY-SA 3.0)

A szövegek kódolására a tudósok egyszerűen az egyes betűknek megfelelő öt egység hosszú DNS-szekvenciákat használták. Így Shakespeare 18. szonettjének első szava, a thou (you;  ’te’) a „TAGATGTGTACAGACTACGC” szekvenciának felel meg.

Hogy teszteljék az eljárás sikerességét, Goldman és Birney átkódolták a szonetteket, a Martin Luther King-beszédet és a Watson és Crick-féle cikket, majd ezt elküldték egy amerikai cégnek, amely azzal foglalkozik, hogy DNS-láncokat állít elő mesterségesen kutatók számára. Néhány héttel később a cég egy kémcsőben elküldte a kód megvalósulását valódi DNS-molekulák formájában. Ahhoz pedig, hogy megbizonyosodjanak arról, hogy a DNS hibátlanul kódolta az információkat, a kémcső tartalmát „végigfuttatták” egy DNS-elemző gépen. Ennek az eredményéből már vissza tudták állítani az eredeti szövegfájlokat.

A mostani kísérlet előzménye, hogy egy harvardi genetikus, George Church a múlt évben DNS-ben archiválta a Regenesis című könyvét, 11 képet és egy számítógépes programot. A cambridge-iek eredményei abban különböznek ettől, hogy másképp korrigálják a DNS írása, illetve olvasása közben keletkező átírási hibákat. A DNS-kód minden egysége négy különböző módon van átírva, és ezekből milliónyi másolat készült. A lehetséges DNS-hibák így valószínűleg csak a láncoknak egy kisebb részét érintik, így ezek kiszűrhetők az ugyanazt kódoló láncok összehasonlításával.

Megemészteni Shakespeare-t...
Megemészteni Shakespeare-t...
(Forrás: Wikimedia Commons )

„A DNS egyik nagyszerű tulajdonsága, hogy nem kell energia ahhoz, hogy tároljuk az információt. Elég, ha hideg száraz és sötét helyen tartjuk, és így nagyon sokáig eláll. Ezt onnan is tudhatjuk, hogy a megfelelő körülmények között megőrzött leletekből egy több tízezer éve élt gyapjas mamut genetikai állományát is elemezni tudjuk” – mondta el Birney. Ma már az sem igaz, hogy az információnak ez a fajta tárolási módja sokkal költségesebb lenne, mint a hagyományos, digitális.

Arra a kérdésre, hogy az így előállított DNS-nek van-e valamiféle egészségügyi kockázata az emberre vagy akár az állatokra nézve, Goldman elmondta: „Az általunk előállított DNS-szekvenciák nem épülhetnek be az emberi vagy az állati genomba, mivel teljesen más kódot használnak, mint az élő szervezetek sejtjei”. Tehát ha valaki mégis felfalná Shakespeare DNS-ben kódolt szonettjeit, azzal nem történne más, mint hogy megemésztené őket... 

Forrás

Shakespeare and Martin Luther King demonstrate potential of DNA storage

Követem a cikkhozzászólásokat (RSS)
Hozzászóláshoz lépjen be vagy regisztráljon.
2 pixel5 2013. január 26. 16:07

" A digitálisan fájlok nullákból és egyekből álló sorozatokként tárolják az információt. A cambridge-i kutatócsoport kódolója pedig minden 8 számjegyből álló sorozatot átkódol egy ötbetűs DNS-kóddá. Például a t betű 8 számjegy hosszúságú digitális kódjának a „TAGAT” DNS-szekvencia felel meg."

Ennek neki kellene futni mégegyszer. Már csak azért is, mert szvsz ez az adattárolási forma kevésbé hatékony mint a bináris.

A t betűnek amúgy sem nyolc számjegy*, hanem nyolc digit (bit) hosszúságú a tárolási kódja, de ez is csak a byte-kódos rendszerekben igaz, az unicode rendszerekben bizony 16 bit.

* Megközelités kérdése, mert éppen a bit is lehet számjegy, de inkább állapot. A gyakorlatban meghatározott számú digitek sorozata tesz ki egy számjegyet.

1 Pesta 2013. január 26. 13:29

Elképzeltem, ahogy néhány tízezer év múlva megtalálnak a tudósok egy ilyet, és az örökítőanyagot leolvasó számítógép meglepetésükre szavalni kezd.

Mindenesetre még eléggé a lyukkártyás fázisban van a technológia, de érdekes lesz 20-30 éven belül csak beugrani a kisboltba néhány milligramm biomasszáért, mert pl. nem fér el a gépen a letöltendő hiper-hatpluszegydés interaktív mozis rip.

Információ
X